articles that identify a problem but don apos t give a solution

Báo cáo y học: "Recently published papers: Clunk-click every trip, smile, but don’t stop for a drink on the way" ppt

Báo cáo y học: "Recently published papers: Clunk-click every trip, smile, but don’t stop for a drink on the way" ppt

Ngày tải lên : 12/08/2014, 20:20
... ventilatory support be, particularly during the first 48 hours? We hope that Tracman, the multicentre UK trial that expects to recruit more than 1200 patients, will provide more answers Spragg and ... plus a maximum of four intratracheal doses of a recombinant surfactant protein C-based surfactant given within 24 hours They failed to demonstrate any difference between control and treatment groups ... critically ill medical patients projected to need ventilatory support for more than 14 days to either early percutaneous dilational tracheotomy within 48 hours or delayed tracheotomy at days...
  • 3
  • 317
  • 0
Low resistance to resettlement in singapore, 1965 1985 a clumsy approach that overcame a wicked problem

Low resistance to resettlement in singapore, 1965 1985 a clumsy approach that overcame a wicked problem

Ngày tải lên : 02/10/2015, 17:15
... revised its resettlement policy twice to ensure that evictees were given attractive compensation rates and benefits Thirdly, the enactment of the Land Acquisition Act was cited as a key factor that ... approach enabled Singapore to avoid the pitfalls that halted resettlement programs in other Asian countries Thirdly, the findings validate that the resettlement program catered to the multitude ... Singapore: An Analysis of Programme Implementation cited the factor of a combination of able administrative leadership at the middle level with the political leadership at the top as an important variable...
  • 170
  • 496
  • 0
Procedural Abstraction and Functions That Return a Value

Procedural Abstraction and Functions That Return a Value

Ngày tải lên : 12/09/2012, 22:48
... Write a function declaration and a function definition for a function that takes one argument of type int and one argument of type double, and that returns a value of type double that is the average ... declaration and a function definition for a function that takes three arguments, all of type int, and that returns the sum of its three arguments?  Describe the call-by-value parameter mechanism? ... meaningful names for formal parameters  Formal parameter names may or may not match variable names used in the main part of the program  It does not matter if formal parameter names match other...
  • 94
  • 541
  • 0
Five stories that are almost true, but not quite

Five stories that are almost true, but not quite

Ngày tải lên : 06/11/2012, 17:33
... had no part They would talk of people and events, the latest gossip or scandal, ridicule this and that and laugh heartily together The theory that opposites attract, did not hold in their case ... Probably the reason is that Jews are just as racist as us Christians That, I couldn 't stomach Mum's veto, that is You see, Daniel's, that' s Dani‟s name, Daniel's father is dead and his mother ... tried to call me on the telephone but I never talked to him after that The funny thing is, I never thought of marriage I did not particularly want to marry Dani, or anyone else for that matter Yes,...
  • 11
  • 460
  • 0
Vocabulary list 10 - Short Words That Mean a Lot

Vocabulary list 10 - Short Words That Mean a Lot

Ngày tải lên : 25/10/2013, 17:20
... that he tried to straighten things out but that they went awry anyway, it is clear that awry must mean when things go off course, or askew When the narrator ekes out the truth, he says that it involved ... We can infer that dire means extreme or unsalvageable because the narrator says that there was no way to get his money back at that point The last sentence describes the narrator’s “so-called ... death; a source of persistent annoyance or exasperation The persistent beetles that continued to eat away at the crop of string beans in spite of all efforts at extermination became the of the farmer’s...
  • 14
  • 865
  • 1
Tài liệu 18 Web-Marketing Concepts That Make a Difference pptx

Tài liệu 18 Web-Marketing Concepts That Make a Difference pptx

Ngày tải lên : 20/12/2013, 17:15
... you are determined to sell to your audience? That' s the one you want to talk about That' s the one you want to devote your marketing effort to promoting That' s the one you want people to think about ... results? So tell me what was the functional thinking that went into the purchase of those leather pants you bought last year, or that 60-inch plasma television you bought just to watch the big game? ... It seems businesses can 't stand to make a definitive statement about who they are and what they Why is that? Afraid they'll lose a customer, I guess; but if people don' t understand exactly what...
  • 6
  • 469
  • 0
Tài liệu Adviceguide Advice that makes a difference pptx

Tài liệu Adviceguide Advice that makes a difference pptx

Ngày tải lên : 15/02/2014, 13:20
... right to appeal against a decision to recover an overpayment of tax credits However, you have the right to appeal against a decision about the amount of an overpayment You can also appeal against ... you don' t get a satisfactory response to your complaint, you can ask the Adjudicator to investigate it Strict time limits apply You can contact the Adjudicator at: Tel: 0300 057 1111 E-mail: adjudicators@gtnet.gov.uk ... possible as there are strict time limits about when you can take further action In certain circumstances, this might include going to court Appealing against your entitlement to tax credit You have...
  • 4
  • 266
  • 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Ngày tải lên : 21/02/2014, 01:21
... Morphological and phenotypic characterization Physiological and biochemical parameters, such as Gram reaction, flagella type, catalase activity, oxidase activity and OF test, were determined using classical ... solution was adjusted to pH 3.0 with M HCl, and the solution was extracted with ethyl acetate The upper layer was collected and evaporated to dryness The single reaction product reacted with methanol ... of its activity after storage at °C for days An inactivation of the enzyme probably led to a decrease in the specific activity between purification steps and The enzyme showed maximal activity in...
  • 7
  • 490
  • 0
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Ngày tải lên : 05/03/2014, 17:20
... indicate that oocytes contain multiple isoforms of PAD Immunohistological data obtained with three different PAD antibodies (anti-ePAD, anti-PAD-V, and ABl2) suggest mouse oocytes contain at least ... conducted to ensure that the PAD and ABL2 labeling were removed from the activated oocyte's surface by high salt treatment and not by DMSO that was used to dissolve ionomycin for artificial activation ... showing that PAD is a peripheral membrane protein A and E are artificially activated oocytes showing released PAD and ABL2 antigen (p75) on the oocyte's surface B and F are artificially activated...
  • 22
  • 519
  • 0
Adviceguide Advice that makes a difference pptx

Adviceguide Advice that makes a difference pptx

Ngày tải lên : 07/03/2014, 11:20
... signing any document that states that you have examined the car and found it satisfactory in all respects Guarantee or extended warranty If the car was sold with a guarantee or an extended warranty, ... case, it will be up to you to show that the car was faulty at the time of sale The longer you have had the car, the more difficult it is to prove that the fault was there at the time of sale If: ... have lost money on a faulty car, don' t waste more money on a case you cannot win Buying a car at a live auction - what the law says If you buy a second hand car at a live auction that you have...
  • 7
  • 366
  • 0
Why Markets Could (But Don’t Currently) Solve Resource Allocation Problems in Systems pot

Why Markets Could (But Don’t Currently) Solve Resource Allocation Problems in Systems pot

Ngày tải lên : 07/03/2014, 17:20
... to maximize overall value Currency is a natural means toward easy valuation expression, but there are other allocation algorithms that not require currency An example are the matching algorithms ... necessity leads to a less desirable, de facto standard the advantages of markets for computational resource allocation Deploying a computational market for resource allocation in the systems domain ... been past systems that take a market approach to resource allocation [1, 2] How, then, will new research into markets for distributed resource allocation be any different? We believe that a number...
  • 6
  • 520
  • 0
Hộp đựng bút đơn giản mà dễ thương pdf

Hộp đựng bút đơn giản mà dễ thương pdf

Ngày tải lên : 11/03/2014, 23:20
... Sau buộc vòng cúc quanh miệng lọ Nếu thích h a ti t, bạn dùng giấy vẽ hình t y thích c t dán quanh lọ, x t sơn vào, để khô Những lọ để b t hay cắm hoa xinh xắn Chúc bạn thành công!...
  • 5
  • 1.7K
  • 2
Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx

Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx

Ngày tải lên : 23/03/2014, 10:20
... 5¢-TCAGTTTTTCAGTCAG TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ and 5¢-GTGAAAAACTGACTGAAAAACTGACTGAAAAAC TGACTGAAAAACTGA-3¢ were annealed to generate a dsDNA fragment, which we named T4 -R¢¢ T4 -R¢¢ was ... double-stranded (ds) oligonucleotide (T4 ¢¢), obtained by annealing oligonucleotides 5¢-GTTTTTCATG TTTTTCATGTTTTTCATGTTTTTCAC-3¢ and 5¢-GTG AAAAACATGAAAAACATGAAAAACATGAAAAAC-3¢, Synthetic oligonucleotides ... TLN-6, P-del and 5¢-AGTCGAGATAACTTCGTATA-3¢; for pLHC20 ⁄ loxP ⁄ -5 ⁄ TLN-6, P-del and 5¢-GTCGAGATA ACTTCGTATAG-3¢; for pLHC20 ⁄ loxP ⁄ -8 ⁄ TLN-6, P-del and 5¢-GAGATAACTTCGTATAGCAT-3¢; and for pLHC20...
  • 12
  • 399
  • 0
RESEMBLANCE AS REPLETENESS: A SOLUTION TO GOODMAN’S PROBLEM pot

RESEMBLANCE AS REPLETENESS: A SOLUTION TO GOODMAN’S PROBLEM pot

Ngày tải lên : 23/03/2014, 13:20
... wanted to represent ‘Tony Blair with a guitar’, semantic density dictates that there must be a mark on the canvas that denotes ‘guitar’, and if there is not, then the picture simply does not ... those features of the depiction that are relevant to representation, and what is representationally relevant here is the detail with which the respective subjects are depicted So the fact that, ... so it seems that there is a sense in which we can say that resemblance runs parallel to repleteness This is the case, at least, if we agree that a picture can resemble its subject to greater and...
  • 7
  • 451
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC...
  • 11
  • 679
  • 0
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Ngày tải lên : 23/03/2014, 15:20
... greater than that of single polyamines, but also that the migration patterns of NAP–DNA complexes differ substantially Namely, the DNA preincubated with l-NAP showed a diffuse migration pattern, ... exclude that modification of the DNA condensation status might play an additional role Theoretically, the possibility exists that the protection of DNA by NAPs depends on modification of the catalytic ... constant DNA protection, NAPs interfere with the DNA condensation status in a temperature-dependent manner We believe that enhancement of the migration speed is attributable to DNA decondensation and...
  • 11
  • 380
  • 0
MẪU THÔNG TIN ĐĂNG KÝ THẤT NGHIỆP A. THÔNG TIN VỀ NGƯỜI LAO ĐỘNG ĐĂNG KÝ THẤT NGHIỆP docx

MẪU THÔNG TIN ĐĂNG KÝ THẤT NGHIỆP A. THÔNG TIN VỀ NGƯỜI LAO ĐỘNG ĐĂNG KÝ THẤT NGHIỆP docx

Ngày tải lên : 25/03/2014, 07:21
... làm trực tiếp Trung t m Giới thiệu việc làm nơi hưởng trợ cấp th t nghiệp tháng lần theo quy định thời gian hưởng trợ cấp th t nghiệp Thông báo cho Trung t m Giới thiệu việc làm nơi hưởng trợ ... hợp cai nghiện Trung t m cai nghiện) chấp hành hình ph t tù khơng hưởng án treo theo mẫu số 21 ban hành kèm theo Thông t số /201…/TT-BLĐTBXH ngày tháng………năm 201……… Bộ Lao động - Thương binh Xã ... ký th t nghiệp Trung t m Giới thiệu việc làm thuộc Sở Lao động - Thương binh Xã hội việc chấm d t hợp đồng lao động hợp đồng làm việc; nộp hồ sơ hưởng bảo hiểm th t nghiệp theo quy định, xu t trình...
  • 2
  • 605
  • 0
the nothing that is, a natural history of zero - robert kaplan

the nothing that is, a natural history of zero - robert kaplan

Ngày tải lên : 05/06/2014, 11:23
... vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that' s 1031), and so through the alluring samaptalambha (1037) and the tongue-twisting visandjnagati (1047) to tallakchana (107 ... Archimedes' estimate wasn 't all that bad This is a spectacular application of the Greek insight that the world afar can be grasped by analogy to the world at hand But it is made much more spectacular when ... was always 6, with a 12 MIND PUTS ITS S T A M P ON MATTER magnitude that common sense and context made clear Some even claim that such flexibility was the greatest advantage of this notation...
  • 238
  • 5.2K
  • 0
– GED LITERATURE AND THE ARTS, READING PRACTICE QUESTIONS – 61. d. It is ironic that in a place pdf

– GED LITERATURE AND THE ARTS, READING PRACTICE QUESTIONS – 61. d. It is ironic that in a place pdf

Ngày tải lên : 18/06/2014, 17:20
... paragraph that expresses the main idea of that paragraph tragedy a play that presents a character’s fall due to a tragic flaw tragic hero the character in a tragedy who falls from greatness and accepts ... thought a writer wants to convey about his or her subject melodrama a play that starts off tragic but has a happy ending memoir an autobiographical text that focuses on a limited number of events and ... responsibility for that fall tragic flaw the characteristic of a hero in a tragedy that causes his or her downfall rhythm 377 – GED LITERATURE AND THE ARTS, READING PRACTICE QUESTIONS – tragicomedy a tragic...
  • 48
  • 435
  • 0